universal reverse pcr primer  (Servicebio Inc)

Journal: Biology of Sex Differences

Article Title: Sex differences in the neuroinflammatory signaling pathway: effect of miRNAs on fatty acid synthesis in microglia

doi: 10.1186/s13293-025-00686-8

Figure Lengend Snippet: Male-enriched miRNAs regulated fatty acid synthesis-related genes. A and B. EMA-Plot representing the significant biological processes identified by Gene Ontology term analysis in male-enriched miRNAs ( A ) and female-enriched miRNAs ( B ). The genes and corresponding miRNAs targeting these processes are listed in Table S3. C Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis of differentially expressed miRNAs enriched in male versus female microglia. The log p-values of the top 10 pathways are shown. The full pathway list is provided in Supplementary Table S5. Significance was calculated using MirPath’s Fisher meta-analysis method. D Quantitative PCR (qPCR) analyses of genes related to fatty acid synthesis and metabolism. Each column represents the mean ± SD of n = 2 samples per sex, each containing pooled hippocampal microglia from five mice. *p < 0.05 versus the corresponding value for females according to Student’s t -test

Article Snippet: The abundance of miRNA was quantified through quantitative PCR (qPCR) using THUNDERBIRD Next SYBR qPCR Mix (Toyobo, Osaka, Japan), in conjunction with the universal PCR reverse primer (Norgen Biotek Corp.) and a specific forward primer designed from the whole sequence of the miRNAs of interest.

Techniques: Real-time Polymerase Chain Reaction

Journal: Aging (Albany NY)

Article Title: Hypoxic BMSC-derived exosomal miR-652-3p promotes proliferation and metastasis of hepatocarcinoma cancer cells via targeting TNRC6A

doi: 10.18632/aging.205025

Figure Lengend Snippet: MiR-652-3p is upregulated in hyoxic BMSCs-derived exosome and can be transferred to HCC cells. ( A ) Transmission electron microscopy (TMB) showed the representative image of BMSCs or hypo-BMSCs derived exosome. ( B ) The particle diameter of the purified exosomes was showed in histogram. ( C ) Exosomal markers were detected by West blotting in BMSCs derived exosome and BMSCs cells. ( D ) Expression of miR-652-3p was detected in exosome derived from BMSCs under different conditions using qRT-PCR. Data were presented as the mean ± SD, and analyzed with Student’s t-test; ** P < 0.01, compared with the indicated controls. ( E ) Expression of miR-652-3p was detected in HepG2 and SMMC-7721 cells after co-culturing with exosome derived from BMSCs under different conditions. Data were presented as the mean ± SD, and analyzed with Student’s t-test. *P < 0.05; ** P < 0.01, compared with the indicated controls.

Article Snippet: miR-652-3p , AATGGCGCCACTAGGGTTGTG , Universal PCR Reverse Primer (cat. no. B532451; Sangon Biotech Co., Ltd.).

Techniques: Derivative Assay, Transmission Assay, Electron Microscopy, Purification, Expressing, Quantitative RT-PCR

Journal: Aging (Albany NY)

Article Title: Hypoxic BMSC-derived exosomal miR-652-3p promotes proliferation and metastasis of hepatocarcinoma cancer cells via targeting TNRC6A

doi: 10.18632/aging.205025

Figure Lengend Snippet: TNRC6A is a direct target of miR-652-3p in human HCC cells. ( A ) The underlying targets of miR-652-3p were predicted using TargetScan and miRDB databases. ( B ) Expression of target genes in HepG2 cells determined by qRT-PCR after transfecting with miR-652-3p mimic. ( C ) Scheme and sequence of the intact miR-652-3p, TNRC6A (Wt) and its mutant (Mut). Computer prediction of miR-652-3p binding sites in the 3’UTR of human TNRC6A gene. ( D ) SMMC-7721 cells were co-transfected with miR-652-3p and WT or MUT 3’UTR of TNRC6A. Data were presented as the mean ± SD, and analyzed with Student’s t-test. ** < 0.01; compared with the indicated NC mimic controls. ( E ) Protein level of TNRC6A was detected by WB in HepG2 and SMMC-7721 cells transfected with NC mimic and miR-652-3p. GAPDH was also detected as a loading control. Data were presented as the mean ± SD, and analyzed with Student’s t-test; ** P < 0.01.

Article Snippet: miR-652-3p , AATGGCGCCACTAGGGTTGTG , Universal PCR Reverse Primer (cat. no. B532451; Sangon Biotech Co., Ltd.).

Techniques: Expressing, Quantitative RT-PCR, Sequencing, Mutagenesis, Binding Assay, Transfection, Control

Journal: Aging (Albany NY)

Article Title: Hypoxic BMSC-derived exosomal miR-652-3p promotes proliferation and metastasis of hepatocarcinoma cancer cells via targeting TNRC6A

doi: 10.18632/aging.205025

Figure Lengend Snippet: Overexpression of miR-652-3p aborted the inhibitive effects of TNRC6A on the proliferation and metastasis of HCC cells. ( A ) The expression of miR-652-3p inHepG2 and SMMC-7721 cells determined by qRT-PCR, Cells were treated with four different means: pcDNA3.1 group, pcDNA3.1-TNRC6A group, co-transfection pcDNA3.1-TNRC6A and NC mimics and co-transfection pcDNA3.1-TNRC6A and miR-652-3p mimic group. Data were presented as the mean ± SD, and analyzed with Student’s t-test *** P < 0.001 ( B ) The mRNA expression of TNRC6A in HepG2 and SMMC-7721 cells determined by qRT-PCR. Data were presented as the mean ± SD, and analyzed with Student’s t-test *P < 0.05; ** P < 0.01. ( C ) The protein expression of TNRC6A in HepG2 and SMMC-7721 cells determined by WB. Histogram show the protein expression of TNRC6A in HepG2 and SMMC-7721 cells. Data were presented as the mean ± SD, and analyzed with Student’s t-test *P < 0.05; **P < 0.01, ***P < 0.001. ( D ) Proliferation of HepG2 and SMMC-7721 cells determined by CCK-8 after treating with different ways, Data were presented as the mean ± SD, and analyzed with Student’s t-test. *P < 0.05 *** P < 0.001. ( E ) Colony formation assay of HepG2 and SMMC-7721 cells after treating with different ways ( F ) Histogram show the amount of colony in HepG2 and SMMC-7721 cells. Data were presented as the mean ± SD, and analyzed with Student’s t-test *P < 0.05; ** P < 0.01 *** P < 0.001. ( G ) Histogram show the distance of cellular migratory in HepG2 and SMMC-7721 cells. Data were presented as the mean ± SD, and analyzed with Student’s t-test *P < 0.05; ** P < 0.01. ( H ) Migration of HepG2 and SMMC-7721 cells determined by wound healing. ( I ) Invasion of HepG2 and SMMC-7721 cells determined by transwell. Cells that invaded to the bottom surface were stained with crystal violet and observed by light microscopy (magnification, 100×). Histogram show the capability of cellular invasion in HepG2 and SMMC-7721 cells. Data were presented as the mean ± SD, and analyzed with Student’s t-test *P < 0.05; ** P < 0.01 *** P < 0.001.

Article Snippet: miR-652-3p , AATGGCGCCACTAGGGTTGTG , Universal PCR Reverse Primer (cat. no. B532451; Sangon Biotech Co., Ltd.).

Techniques: Over Expression, Expressing, Quantitative RT-PCR, Cotransfection, CCK-8 Assay, Colony Assay, Migration, Staining, Light Microscopy

Journal: Aging (Albany NY)

Article Title: Hypoxic BMSC-derived exosomal miR-652-3p promotes proliferation and metastasis of hepatocarcinoma cancer cells via targeting TNRC6A

doi: 10.18632/aging.205025

Figure Lengend Snippet: Primers for qRT-PCR.

Article Snippet: miR-652-3p , AATGGCGCCACTAGGGTTGTG , Universal PCR Reverse Primer (cat. no. B532451; Sangon Biotech Co., Ltd.).

Techniques: